Showing tool doc from version 4.6.2.0 | The latest version is
4.6.2.0

ReferenceBases

Annotate with local reference bases (REF_BASES)

Category Variant Annotations


Overview

Local reference context at a variant position.

The annotation gives ten reference bases each to the left and right of the variant start and the start base for a total of 21 reference bases. Start position is defined as one base before indels. For example, the reference context AAAAAAAAAACTTTTTTTTTT would apply to a SNV variant context with ref allele C and alt allele G as well as to a deletion variant context with ref allele CT and alt allele C.


Return to top


See also General Documentation | Tool Docs Index Tool Documentation Index | Support Forum

GATK version 4.6.2.0 built at Sun, 13 Apr 2025 13:21:43 -0400.