ReferenceBases
Annotate with local reference bases (REF_BASES)
Category
Variant Annotations
Overview
Local reference context at a variant position.
The annotation gives ten reference bases each to the left and right of the variant start and the start base for a total of 21 reference bases.
Start position is defined as one base before indels. For example, the reference context AAAAAAAAAACTTTTTTTTTT would apply to a SNV variant
context with ref allele C and alt allele G as well as to a deletion variant context with ref allele CT and alt allele C.
Return to top
See also
General Documentation |
Tool Docs Index Tool Documentation Index |
Support Forum
GATK version 4.6.2.0 built at Sun, 13 Apr 2025 13:21:43 -0400.