Funcotator

Functional Annotator

Category Variant Evaluation and Refinement

Overview

Funcotator (FUNCtional annOTATOR) analyzes given variants for their function (as retrieved from a set of data sources) and produces the analysis in a specified output file.

This tool is a functional annotation tool that allows a user to add annotations to called variants based on a set of data sources, each with its own matching criteria.

Detailed Information and Tutorial

Detailed information and a tutorial can be found here:

https://gatk.broadinstitute.org/hc/en-us/articles/360035889931-Funcotator-Information-and-Tutorial

Data Sources

Data sources are expected to be in folders that are specified as input arguments. While multiple data source folders can be specified, no two data sources can have the same name.

Data Source Folders

In each main data source folder, there should be sub-directories for each individual data source, with further sub-directories for a specific reference (i.e. hg19 or hg38). In the reference-specific data source directory, there is a configuration file detailing information about the data source and how to match it to a variant. This configuration file is required.

An example of a data source directory is the following:

         dataSourcesFolder/
              Data_Source_1/
                  hg19
                      data_source_1.config
                      data_source_1.data.file.one
                      data_source_1.data.file.two
                      data_source_1.data.file.three
                      ...
                   hg38
                      data_source_1.config
                      data_source_1.data.file.one
                      data_source_1.data.file.two
                      data_source_1.data.file.three
                      ...
              Data_Source_2/
                  hg19
                      data_source_2.config
                      data_source_2.data.file.one
                      data_source_2.data.file.two
                      data_source_2.data.file.three
                      ...
                   hg38
                      data_source_2.config
                      data_source_2.data.file.one
                      data_source_2.data.file.two
                      data_source_2.data.file.three
                      ...
               ...

Pre-packaged Data Sources

The GATK includes two sets of pre-packaged data sources, allowing for {@link Funcotator} use without (much) additional configuration. These data source packages correspond to the germline and somatic use cases. Broadly speaking, if you have a germline VCF, the germline data sources are what you want to use to start with. Conversely, if you have a somatic VCF, the somatic data sources are what you want to use to start with.
Versioned gzip archives of data source files are provided here:

gnomAD

The pre-packaged data sources include gnomAD, a large database of known variants. gnomAD is split into two parts - one based on exome data, one based on whole genome data. Due to the size of gnomAD, it cannot be included in the data sources package directly. Instead, the configuration data are present and point to a Google bucket in which the gnomAD data reside. This will cause {@link Funcotator} to actively connect to that bucket when it is run.
For this reason, gnomAD is disabled by default.
To enable gnomAD, simply change directories to your data sources directory and untar the gnomAD tar.gz files:

         cd DATA_SOURCES_DIR
         tar -zxf gnomAD_exome.tar.gz
         tar -zxf gnomAD_genome.tar.gz

Because {@link Funcotator} will query the Internet when gnomAD is enabled, performance will be impacted by the machine's Internet connection speed. If this degradation is significant, you can localize gnomAD to the machine running {@link Funcotator} to improve performance (however due to the size of gnomAD this may be impractical).

Data Source Downloader Tool

To improve ease-of-use of {@link Funcotator}, there is a tool to download the pre-packaged data sources to the user's machine. This tool is the {@link FuncotatorDataSourceDownloader} and can be run to retrieve the pre-packaged data sources from the google bucket and localize them to the machine on which it is run.
Briefly:

For somatic data sources:

{@code ./gatk FuncotatorDataSourceDownloader --somatic --validate-integrity --extract-after-download}

For germline data sources:

{@code ./gatk FuncotatorDataSourceDownloader --germline --validate-integrity --extract-after-download}

Disabling Data Sources

A data source can be disabled by removing the folder containing the configuration file for that source. This can be done on a per-reference basis. If the entire data source should be disabled, the entire top-level data source folder can be removed.

If it is possible that the data source will be re-enabled in the future, then we recommend zipping the data source folder and removing the folder itself, leaving only the zip file in its place. When the time comes to enable data source again, simply unzip the file and the data source will be ready to go the next time {@link Funcotator} is run.

User-Defined Data Sources

Users can define their own data sources by creating a new correctly-formatted data source sub-directory in the main data sources folder. In this sub-directory, the user must create an additional folder for the reference for which the data source is valid. If the data source is valid for multiple references, then multiple reference folders should be created. Inside each reference folder, the user should place the file(s) containing the data for the data source. Additionally the user must create a configuration file containing metadata about the data source.

{@link Funcotator} allows for data sources with source files that live on the cloud, enabling users to annotate with data sources that are not physically present on the machines running {@link Funcotator}.
To create a data source based on the cloud, create a configuration file for that data source and put the cloud URL in as the src_file property (see Configuration File Format for details).
E.g.:

         ...
         src_file = gs://broad-references/hg19/v0/1000G_phase1.snps.high_confidence.b37.vcf.gz
         ...

There are several formats allowed for data sources, however the two most useful are arbitrarily separated value (XSV) files, such as comma-separated value (CSV), tab-separated value (TSV). These files contain a table of data that can be matched to a variant by gene name, transcript ID, or genome position. In the case of gene name and transcript ID, one column must contain the gene name or transcript ID for each row's data.

For gene name, when a variant is annotated with a gene name that exactly matches an entry in the gene name column for a row, that row's other fields will be added as annotations to the variant.
For transcript ID, when a variant is annotated with a transcript ID that exactly matches an entry in the transcript ID column for a row, that row's other fields will be added as annotations to the variant.
For genome position, one column must contain the contig ID, another column must contain the start position (1-based, inclusive), and a column must contain the stop position (1-based, inclusive). The start and stop columns may be the same column. When a variant is annotated with a genome position that overlaps an entry in the three genome position columns for a row, that row's other fields will be added as annotations to the variant.

Configuration File Format

The configuration file is a standard Java properties-style configuration file with key-value pairs. This file name must end in .config.

The following is an example of a genome position XSV configuration file (for the ORegAnno data source):

         name = Oreganno
         version = 20160119
         src_file = oreganno.tsv
         origin_location = http://www.oreganno.org/dump/ORegAnno_Combined_2016.01.19.tsv
         preprocessing_script = getOreganno.py

         # Supported types:
         # simpleXSV    -- Arbitrary separated value table (e.g. CSV), keyed off Gene Name OR Transcript ID
         # locatableXSV -- Arbitrary separated value table (e.g. CSV), keyed off a genome location
         # gencode      -- Custom datasource class for GENCODE
         # cosmic       -- Custom datasource class for COSMIC
         # vcf          -- Custom datasource class for Variant Call Format (VCF) files
         type = locatableXSV

         # Required field for GENCODE files.
         # Path to the FASTA file from which to load the sequences for GENCODE transcripts:
         gencode_fasta_path =

         # Required field for GENCODE files.
         # NCBI build version (either hg19 or hg38):
         ncbi_build_version =

         # Required field for simpleXSV files.
         # Valid values:
         #     GENE_NAME
         #     TRANSCRIPT_ID
         xsv_key =

         # Required field for simpleXSV files.
         # The 0-based index of the column containing the key on which to match
         xsv_key_column =

         # Required field for simpleXSV AND locatableXSV files.
         # The delimiter by which to split the XSV file into columns.
         xsv_delimiter = \t

         # Required field for simpleXSV files.
         # Whether to permissively match the number of columns in the header and data rows
         # Valid values:
         #     true
         #     false
         xsv_permissive_cols = true

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the contig for each row
         contig_column = 1

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the start position for each row
         start_column = 2

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the end position for each row
         end_column = 3

Required Inputs

A reference genome sequence.
The version of the reference genome sequence being used (e.g. hg19, hg38, etc.).
A VCF of variant calls to annotate.
The path to a folder of data sources formatted for use by Funcotator.
The desired output format for the annotated variants file (either MAF or VCF)

Output

The basic output of {@link Funcotator} is:

A VCF or MAF file containing all variants from the input file with added annotations corresponding to annotations from each data source that matched a given variant according to that data source's matching criteria.

Annotations for Pre-Packaged Data Sources

The pre-packaged data sources will create a set of baseline, or default annotations for an input data set. Most of these data sources copy and paste values from their source files into the output of {@link Funcotator} to create annotations. In this sense they are trivial data sources.

Gencode

{@link Funcotator} performs some processing on the input data to create the Gencode annotations. Gencode is currently required, so {@link Funcotator} will create these annotations for all input variants. The order and a specification of the Gencode annotations that {@link Funcotator} creates is as follows:

hugoSymbol
Type: {@link String}
The name of the gene in which the annotated variant allele occurs. If the variant allele occurs outside of any known gene boundaries, then this field is set to "Unknown".
ncbiBuild
Type: {@link String}
The reference which was used to create this Gencode annotation. Current valid values are: "hg19" or "hg38".
chromosome
Type: {@link String}
The contig in which the variant occurs. Will always correspond to the contig in the variant position.
start
Type: {@link Integer}
The start position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the start in the variant position.
end
Type: {@link Integer}
The end position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the position last base in the variant allele.
variantClassification
Type: {@link String}
The classification of the variant being annotated. Will always be one of the following:
- COULD_NOT_DETERMINE
  Variant classification could not be determined.
- INTRON
  Variant lies between exons within the bounds of the chosen transcript. Only valid for Introns.
- FIVE_PRIME_UTR
  Variant is on the 5'UTR for the chosen transcript. Only valid for UTRs.
- THREE_PRIME_UTR
  Variant is on the 3'UTR for the chosen transcript Only valid for UTRs.
- IGR
  Intergenic region. Does not overlap any transcript. Only valid for IGRs.
- FIVE_PRIME_FLANK
  The variant is upstream of the chosen transcript Only valid for IGRs.
- THREE_PRIME_FLANK
  The variant is downstream of the chosen transcript Only valid for IGRs.
- MISSENSE
  The point mutation alters the protein structure by one amino acid. Can occur in Coding regions or Introns.
- NONSENSE
  A premature stop codon is created by the variant. Can occur in Coding regions or Introns.
- NONSTOP
  Variant removes stop codon. Can occur in Coding regions or Introns.
- SILENT
  Variant is in coding region of the chosen transcript, but protein structure is identical. Can occur in Coding regions or Introns.
- SPLICE_SITE
  The variant is within a configurable number of bases of a splice site. See the secondary classification to determine if it lies on the exon or intron side. Can occur in Coding regions or Introns.
- IN_FRAME_DEL
  Deletion that keeps the sequence in frame. Can occur in Coding regions or Introns.
- IN_FRAME_INS
  Insertion that keeps the sequence in frame. Can occur in Coding regions or Introns.
- FRAME_SHIFT_INS
  Insertion that moves the coding sequence out of frame. Can occur in Coding regions or Introns.
- FRAME_SHIFT_DEL
  Deletion that moves the sequence out of frame. Can occur in Coding regions or Introns.
- START_CODON_SNP
  Point mutation that overlaps the start codon. Can occur in Coding regions or Introns.
- START_CODON_INS
  Insertion that overlaps the start codon. Can occur in Coding regions or Introns.
- START_CODON_DEL
  Deletion that overlaps the start codon. Can occur in Coding regions or Introns.
- DE_NOVO_START_IN_FRAME
  New start codon is created by the given variant using the chosen transcript. However, it is in frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would be in frame with the existing start and stop codons. This can only occur in a 5' UTR.
- DE_NOVO_START_OUT_FRAME
  New start codon is created by the given variant using the chosen transcript. However, it is out of frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would NOT be in frame with the existing start and stop codons. This can only occur in a 5' UTR.
- RNA
  Variant lies on one of the RNA transcripts. (special catch-all case)
- LINCRNA
  Variant lies on one of the lincRNAs. (special catch-all case)
secondaryVariantClassification
Type: {@link String}
Additional variant classification information for variant alleles that have a {@code variantClassification} of {@code SPLICE_SITE}. For a variant allele with the {@code variantClassification} of {@code SPLICE_SITE}, this will indicate the specific classification of the variant. For all variants that do not have the {@code variantClassification} of {@code SPLICE_SITE}, this will be the empty string.
variantType
Type: {@link String}
Basic information about the variant allele being annotated. Can be one of:
- INS - The variant allele is some kind of insertion.
- DEL - The variant allele is some kind of deletion.
- SNP - The variant allele is a single nucleotide polymorphism.
- DNP - The variant allele is a di-nucleotide polymorphism.
- TNP - The variant allele is a tri-nucleotide polymorphism.
- ONP - The variant allele is an oligo-nucleotide polymorphism (Synonymous with MNP).
- MNP - The variant allele is a multi-nucleotide polymorphism (Synonymous with ONP).
- NA - The variant allele type cannot be determined.
refAllele
Type: {@link String}
The reference allele for the position at which this this variant allele occurs.
For insertions, this will be set to "-".
tumorSeqAllele1
Type: {@link String}
Always the same as the reference allele. This field is a hold-over required for MAF annotations.
For insertions, this will be set to "-".
tumorSeqAllele2
Type: {@link String}
The variant allele being annotated. This field only includes the bases that are different from the reference.
For the input VCF records, this field may slightly differ from the alternate allele reported in the base data for the {@link VariantContext}.
For deletions, this will be set to "-".
genomeChange
Type: {@link String}
A {@link String} summarizing the change resulting from this variant allele within the context of the whole genome sequence.
Generally the format of this field is:
```
             g.[CONTIG]:[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on {@code VariantType}:
- Insertion
```
g.[CONTIG]:[POSITION OF BASE PRIOR TO INSERTION];_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
```
  E.g.:
```
g.chr19:2018023_2018024insAATCG
```
  This indicates that the bases AATCG were inserted between bases 2018023 and 2018024 on chromosome 19.
- Deletion
```
g.[CONTIG]:[POSITION OF BASE DELETED]del[BASE DELETED]
```
  E.g.:
```
g.chr19:2018023delT
```
  This indicates that the base T was deleted at position 2018023 on chromosome 19. OR
```
g.[CONTIG]:[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
```
  E.g.:
```
g.chr19:2018023_2018025delTTG
```
  This indicates that the bases TTG were deleted starting at position 2018023 and ending at position 2018025 on chromosome 19.
- SNP
```
g.[CONTIG]:[POSITION OF BASE ALTERED][REFERENCE BASE]>[ALTERNATE BASE]
```
  E.g.:
```
g.chr19:2018023T>G
```
  This indicates that the base T was changed to G at position 2018023 on chromosome 19.
- MNP (including DNPs, TNPs)
```
g.[CONTIG]:[POSITION OF FIRST BASE ALTERED]_[POSITION OF LAST BASE ALTERED][REFERENCE BASES>>[ALTERNATE BASES]
```
  E.g.:
```
g.chr19:2018023_2018025TTG>GAT
```
  This indicates that the bases TTG were changed to GAT from position 2018023 to position 2018025 on chromosome 19.
annotationTranscript
Type: {@link String}
The ID of the transcript chosen for the detailed Gencode annotation reporting.
E.g.: ENST00000435064.1
If the variant allele does not occur within the bounds of any transcript (e.g. is of type IGR), then this field is empty.
transcriptStrand
Type: {@link String}
The strand direction associated with the transcript on which this variant allele occurs.
Either "+" or "-".
transcriptExon
Type: {@link Integer} or Empty
The exon number on the transcript in which this variant allele occurs (1-based). Corresponds directly to the Gencode exon number.
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type INTRON or IGR), then this field is empty.
transcriptPos
Type: {@link Integer} or Empty
Position in the chosen transcript of the variant allele. All positions listed are 1-based and inclusive (meaning that the first base in the transcript starts at and ends at position 1).
For variant alleles that occur at a single base, the format is simply the position at which that variant occurs in the transcript (e.g. 1294)
For variant alleles spanning multiple bases, the format is:
```
             [START]_[END]
             
```
E.g.:
```
1236_1237
```
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type INTRON or IGR), then this field is empty.
cDnaChange
Type: {@link String}
A {@link String} that summarizes the change resulting from this variant allele in the coding sequence for the transcript in which it occurs.
Positions in this field are relative to the start of the transcript (1-based, inclusive) unless otherwise noted.
Generally the format of this field is:
```
             c.[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on {@code VariantType}, the number of affected bases, and whether the variant allele is a SPLICE_SITE:
- Insertions
```
c.[POSITION OF BASE PRIOR TO INSERTION]_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
```
  E.g.:
```
c.2018_2019insAA
```
  This indicates that the bases AA were inserted between bases 2018 and 2019 in the transcript associated with this variant allele.
- Deletions of One Base
```
c.[POSITION OF BASE DELETED]del[BASE DELETED]
```
  E.g.:
```
c2018delT
```
  This indicates that the base T was deleted at position 2018 in the transcript associated with this variant allele.
- Deletions of Multiple Bases
```
c.[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
```
  E.g.:
```
c2018_2022delTTCAG
```
  This indicates that the bases TTCAG were deleted from position 2018 to position 2022 in the transcript associated with this variant allele.
- SNPs
```
c.[POSITION OF BASE CHANGED]>[NEW BASE]
```
  E.g.:
```
c.1507T>G
```
  This indicates that the base T was changed to G at position 1507 in the transcript associated with this variant allele.
- MNPs (including DNPs, TNPs)
```
c.[POSITION OF FIRST BASE CHANGED]_[POSITION OF LAST BASE CHANGED]>[NEW BASES]
```
  E.g.:
```
c.12899_12900AG>TA
```
  This indicates that the bases AG were changed to TA from position 12899 to position 12900 in the transcript associated with this variant allele.
- INTRONIC Variants
  For variants occuring in INTRONs, the cDNA string position indicates the offset from the exon boundary for the start of the variant. The whole string takes the form:
```
c.e[EXON NUMBER][+|-][BASES FROM EXON][REF ALLELE]>[ALT ALLELE]
```
  E.g.:
```
c.e81-4TAA>A
```
  This indicates that the bases TAA were changed to A starting four bases before exon 81 in the transcript associated with this variant allele.
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type IGR), then this field is empty.
codonChange
Type: {@link String}
A {@link String} that representing the codon-aligned change resulting from this variant allele in the coding sequence for the transcript in which it occurs.
Positions in this field are relative to the start of the transcript (1-based, inclusive) and aligned to the coding sequenceunless otherwise noted.
Unlike the cDnaChange, the bases reported in the codonChange string will always have a length evenly divisble by 3 (except for frameshifts) and represent what the codons would be if the variant alternate allele were expressed in the reference sequence.
Capitalized bases represent the bases changed by the variant alternate allele. Lower-case bases represent reference bases.
Generally the format of this field is:
```
             c.[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on {@code VariantType}, the number of affected bases, and whether the variant allele occurs in an Intron:
- In-Frame Insertions
```
c.([POSITION OF FIRST BASE IN FIRST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT]-[POSITION OF LAST BASE IN LAST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(19-21)ctt>ctCGTt
```
  This indicates that the bases CGT were inserted before the 6th codon (starting at base 19, ending at base 21) in the transcript associated with this variant allele, and the resulting expressed codons would be ctCGTt.
- In-Frame Deletions of Complete Codons (codon-aligned deletions)
```
c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]del
```
  E.g.:
```
c.(997-999)gcadel
```
  This indicates that the 332nd codon (starting at base 997, ending at base 999) was deleted in the transcript associated with this variant allele, and the deleted codon bases are gca.
- In-Frame Deletions Spanning Multiple Codons
```
c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(997-1002)gcactc>gtc
```
  This indicates that bases in the 332nd codon (starting at base 997) and 333rd codon (ending at base 1002) were deleted in the transcript associated with this variant allele, and the resulting expressed codon would be gtc.
- Frame Shift Insertions and Deletions
```
c.([POSITION OF FIRST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON]-[POSITION OF LAST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(997-999)gcafs
```
  This indicates that bases just AFTER the 332nd codon (starting at base 997, ending at base 999) were inserted or deleted in the transcript associated with this variant allele resulting in a frame shift, and that the last correctly transcribed codon would be codon 332 (starting at base 997, ending at base 999), 'gca'.
proteinChange
Type: {@link String}
A short string representing the predicted amino acid sequence change in the product of the gene transcript in which this variant alternate allele occurs.
Positions in this field are relative to the start of the amino acid sequence (1-based, inclusive) resulting from decoding the codons in the transcript in which this variant alternate allele occursunless otherwise noted.
Amino acid abbreviations are the standard letters as can be found in this table with the exception of the stop codon, which is represented by '*'.
It is important to note that the positions and amino acids reported in this string may not directly align to the codons in which the variant alternate allele occurs. This is most often due to the variant occuring in a set of tandem repeats which would cause the amino acid change to be "pushed" to the end of the tandem repeats.
For protein change strings in the Mitochondrial contig, the mitochondrial genetic code is used (rather than the standard code). The format of this field takes two forms:
- Protein Changes with One Amino Acid Changed
```
p.[REFERENCE AMINO ACID][POSITION][PREDICTED EXPRESSED AMINO ACID]
```
  E.g. 1:
```
p.V5T
```
  The amino acid at protein position 5 was V (Valine) in the reference and would become T (Threonine) with the variant alternate allele expressed.
  E.g. 2:
```
p.R2R
```
  The amino acid at protein position 2 was R (Argenine) in the reference and would become R (Argenine) with the variant alternate allele expressed (no change in amino acid sequence / silent variant classification).
- Protein Changes with Multiple Amino Acids Changed
```
p.[FIRST AFFECTED AMINO ACID POSITION]_[LAST AFFECTED AMINO ACID POSITION][REFERENCE AMINO ACIDS]>[PREDICTED EXPRESSED AMINO ACIDS]
```
  E.g.:
```
p.100_101Q*>FL
```
  The amino acid sequence starting at protein position 100 and ending at protein position 101 was Q* (Glutamine,STOP) in the reference and would become FL (Phenylalanine,Leucine) with the variant alternate allele expressed.
If the variant alternate allele does not occur in a coding region, this field will be empty.
gcContent
Type: {@link Double}
Represents the fraction of Guanine and Cytosine bases in a window of a given size around a variant. This window size does not include any bases in the variant alternate allele itself. By default the window size is 200 bases.

referenceContext
Type: {@link String}
The strand-correct reference coding sequence in a given window around the reference allele. By default the window size is 10 bases.
E.g. For the reference context around a variant with the reference allele 'C' on the '+' strand:

                      [REF ALLELE]
                           |
                           v
                 GAACCCACGTCGGTGAGGGCC
                 |________| |________|
                     v           v
                  10 bases      10 bases
                (window size)  (window size)

Strand-correct specifically means that if the strand of this transcript is determined to be '-' then the sequence is reverse complemented.
E.g. For the reference context around a variant with the reference allele 'C' on the '-' strand:

                      [REF ALLELE]
                           |
                           v
                 CACGAAAGTCTTGCGGATCT
                 |________| |________|
                     v           v
                  10 bases      10 bases
                (window size)  (window size)

otherTranscripts
Type: {@link String}
A summary of the other transcripts in which this variant occurs, which were not chosen for detailed reporting due to the transcript selection scheme.
Each other transcript is represented by a condensed string that indicates how that transcript would be affected by this variant alternate allele.
Each other transcript takes the form:
```
[HUGO SYMBOL]_[TRANSCRIPT ID]_[VARIANT CLASSIFICATION]_[PROTEIN CHANGE STRING]
```
E.g.:
```
SDF4_ENST00000263741.7_MISSENSE_p.R243Q
```
If another transcript were to be an IGR, the other transcript field would be populated with 'IGR_ANNOTATON'
If the other transcript does not have a protein change string, then that part is not rendered.
In the event that there are multiple other transcripts, these transcripts are separated by '/'.
E.g.:
```
SDF4_ENST00000263741.7_MISSENSE_p.R243Q/TNFRSF4_ENST00000379236.3_FIVE_PRIME_FLANK
```
If this variant alternate allele occurs in only one transcript, this field will be empty.

Other annotations will follow the Gencode annotations and will be based on the data sources included in the data sources directory.

Usage example

   ./gatk Funcotator \
   -R reference.fasta \
   -V input.vcf \
   -O outputFile \
   --output-file-format MAF \
   --data-sources-path dataSourcesFolder/ \
   --ref-version hg19

Notes

This tool is the spiritual successor to Oncotator, with better support for germline data, numerous fixes for correctness, and many other features.
REMEMBER: Funcotator is NOT Oncotator.

Known Issues

A complete list of known open issues can be found on the GATK github entry for funcotator here.

Additional Information

Read filters

This Read Filter is automatically applied to the data by the Engine before processing by Funcotator.

WellformedReadFilter

Funcotator specific arguments

This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.

Argument name(s)	Default value	Summary
Required Arguments
--data-sources-path		The path to a data source folder for Funcotator. May be specified more than once to handle multiple data source folders.
--output -O		Output file to which annotated variants should be written.
--output-file-format		The output file format. Either VCF, MAF, or SEG. Please note that MAF output for germline use case VCFs is unsupported. SEG will generate two output files: a simple tsv and a gene list.
--ref-version		The version of the Human Genome reference to use (e.g. hg19, hg38, etc.). This will correspond to a sub-folder of each data source corresponding to that data source for the given reference.
--reference -R		Reference sequence file
--variant -V		A VCF file containing variants
Optional Tool Arguments
--annotation-default		Annotations to include in all annotated variants if the annotation is not specified in the data sources (in the format :). This will add the specified annotation to every annotated variant if it is not already present.
--annotation-override		Override values for annotations (in the format :). Replaces existing annotations of the given name with given values.
--arguments_file		read one or more arguments files and add them to the command line
--cloud-index-prefetch-buffer -CIPB	-1	Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.
--cloud-prefetch-buffer -CPB	40	Size of the cloud-only prefetch buffer (in MB; 0 to disable).
--custom-variant-classification-order		TSV File containing custom Variant Classification severity map of the form: VARIANT_CLASSIFICATION SEV. VARIANT_CLASSIFICATION must match one of the VariantClassification names (COULD_NOT_DETERMINE, INTRON, FIVE_PRIME_UTR, THREE_PRIME_UTR, IGR, FIVE_PRIME_FLANK, THREE_PRIME_FLANK, MISSENSE, NONSENSE, NONSTOP, SILENT, SPLICE_SITE, IN_FRAME_DEL, IN_FRAME_INS, FRAME_SHIFT_INS, FRAME_SHIFT_DEL, START_CODON_SNP, START_CODON_INS, START_CODON_DEL, DE_NOVO_START_IN_FRAME, DE_NOVO_START_OUT_FRAME, RNA, LINCRNA). SEV is an unsigned integer, where lower is sorted first. When using this option it is HIGHLY recommended you also use the `BEST_EFFECT` transcript selection mode.
--disable-bam-index-caching -DBIC	false	If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.
--disable-sequence-dictionary-validation	false	If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!
--exclude-field		Fields that should not be rendered in the final output. Only exact name matches will be excluded.
--five-prime-flank-size	5000	Variants within this many bases of the 5' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 5' flanking region of that transcript
--gcs-max-retries -gcs-retries	20	If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection
--gcs-project-for-requester-pays		Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed. User must have storage.buckets.get permission on the bucket being accessed.
--help -h	false	display the help message
--interval-merging-rule -imr	ALL	Interval merging rule for abutting intervals
--intervals -L		One or more genomic intervals over which to operate
--lookahead-cache-bp	100000	Number of base-pairs to cache when querying variants. Can be overridden in individual data source configuration files.
--reannotate-vcf	false	When input VCF has already been annotated, still annotate again.
--remove-filtered-variants	false	Ignore/drop variants that have been filtered in the input. These variants will not appear in the output file.
--sites-only-vcf-output	false	If true, don't emit genotype fields when writing vcf file output.
--splice-site-window-size	2	Number of bases on either side of a splice site for a variant to be classified as a SPLICE_SITE variant (default: 2).
--three-prime-flank-size	0	Variants within this many bases of the 3' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 3' flanking region of that transcript
--transcript-list		File to use as a list of transcripts (one transcript ID per line, version numbers are ignored) OR A set of transcript IDs to use for annotation to override selected transcript.
--transcript-selection-mode	CANONICAL	Method of detailed transcript selection. This will select the transcript for detailed annotation (CANONICAL, ALL, or BEST_EFFECT).
--version	false	display the version number for this tool
Optional Common Arguments
--add-output-sam-program-record	true	If true, adds a PG tag to created SAM/BAM/CRAM files.
--add-output-vcf-command-line	true	If true, adds a command line header line to created VCF files.
--create-output-bam-index -OBI	true	If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.
--create-output-bam-md5 -OBM	false	If true, create a MD5 digest for any BAM/SAM/CRAM file created
--create-output-variant-index -OVI	true	If true, create a VCF index when writing a coordinate-sorted VCF file.
--create-output-variant-md5 -OVM	false	If true, create a a MD5 digest any VCF file created.
--disable-read-filter -DF		Read filters to be disabled before analysis
--disable-tool-default-read-filters	false	Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)
--exclude-intervals -XL		One or more genomic intervals to exclude from processing
--gatk-config-file		A configuration file to use with the GATK.
--input -I		BAM/SAM/CRAM file containing reads
--interval-exclusion-padding -ixp	0	Amount of padding (in bp) to add to each interval you are excluding.
--interval-padding -ip	0	Amount of padding (in bp) to add to each interval you are including.
--interval-set-rule -isr	UNION	Set merging approach to use for combining interval inputs
--inverted-read-filter -XRF		Inverted (with flipped acceptance/failure conditions) read filters applied before analysis (after regular read filters).
--lenient -LE	false	Lenient processing of VCF files
--max-variants-per-shard	0	If non-zero, partitions VCF output into shards, each containing up to the given number of records.
--QUIET	false	Whether to suppress job-summary info on System.err.
--read-filter -RF		Read filters to be applied before analysis
--read-index		Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.
--read-validation-stringency -VS	SILENT	Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
--seconds-between-progress-updates	10.0	Output traversal statistics every time this many seconds elapse
--sequence-dictionary		Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.
--tmp-dir		Temp directory to use.
--use-jdk-deflater -jdk-deflater	false	Whether to use the JdkDeflater (as opposed to IntelDeflater)
--use-jdk-inflater -jdk-inflater	false	Whether to use the JdkInflater (as opposed to IntelInflater)
--verbosity	INFO	Control verbosity of logging.
Advanced Arguments
--min-num-bases-for-segment-funcotation	150	The minimum number of bases for a variant to be annotated as a segment. Recommended to be changed only for use with FuncotateSegments. Defaults to 150
--prefer-mane-transcripts	false	If this flag is set, Funcotator will prefer 'MANE_Plus_Clinical' followed by 'MANE_select' transcripts (including those not tagged 'basic') if one is present for a given variant. If neither tag is present it use the default behavior (only base transcripts).
--showHidden	false	display hidden arguments
--variant-output-filtering		Restrict the output variants to ones that match the specified intervals according to the specified matching mode.

Argument details

Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.

--add-output-sam-program-record / -add-output-sam-program-record

If true, adds a PG tag to created SAM/BAM/CRAM files.

boolean true

--add-output-vcf-command-line / -add-output-vcf-command-line

If true, adds a command line header line to created VCF files.

boolean true

--annotation-default

Annotations to include in all annotated variants if the annotation is not specified in the data sources (in the format :). This will add the specified annotation to every annotated variant if it is not already present.

List[String] []

--annotation-override

Override values for annotations (in the format :). Replaces existing annotations of the given name with given values.

List[String] []

--arguments_file

read one or more arguments files and add them to the command line

List[File] []

--cloud-index-prefetch-buffer / -CIPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.

int -1 [ [ -∞ ∞ ] ]

--cloud-prefetch-buffer / -CPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable).

int 40 [ [ -∞ ∞ ] ]

--create-output-bam-index / -OBI

If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.

boolean true

--create-output-bam-md5 / -OBM

If true, create a MD5 digest for any BAM/SAM/CRAM file created

boolean false

--create-output-variant-index / -OVI

If true, create a VCF index when writing a coordinate-sorted VCF file.

boolean true

--create-output-variant-md5 / -OVM

If true, create a a MD5 digest any VCF file created.

boolean false

--custom-variant-classification-order

TSV File containing custom Variant Classification severity map of the form: VARIANT_CLASSIFICATION SEV. VARIANT_CLASSIFICATION must match one of the VariantClassification names (COULD_NOT_DETERMINE, INTRON, FIVE_PRIME_UTR, THREE_PRIME_UTR, IGR, FIVE_PRIME_FLANK, THREE_PRIME_FLANK, MISSENSE, NONSENSE, NONSTOP, SILENT, SPLICE_SITE, IN_FRAME_DEL, IN_FRAME_INS, FRAME_SHIFT_INS, FRAME_SHIFT_DEL, START_CODON_SNP, START_CODON_INS, START_CODON_DEL, DE_NOVO_START_IN_FRAME, DE_NOVO_START_OUT_FRAME, RNA, LINCRNA). SEV is an unsigned integer, where lower is sorted first. When using this option it is HIGHLY recommended you also use the `BEST_EFFECT` transcript selection mode.

GATKPath null

--data-sources-path

The path to a data source folder for Funcotator. May be specified more than once to handle multiple data source folders.

R List[String] []

--disable-bam-index-caching / -DBIC

If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.

boolean false

--disable-read-filter / -DF

Read filters to be disabled before analysis

List[String] []

--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation

If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!

boolean false

--disable-tool-default-read-filters / -disable-tool-default-read-filters

Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)

boolean false

--exclude-field

Fields that should not be rendered in the final output. Only exact name matches will be excluded.

Set[String] []

--exclude-intervals / -XL

One or more genomic intervals to exclude from processing
Use this argument to exclude certain parts of the genome from the analysis (like -L, but the opposite). This argument can be specified multiple times. You can use samtools-style intervals either explicitly on the command line (e.g. -XL 1 or -XL 1:100-200) or by loading in a file containing a list of intervals (e.g. -XL myFile.intervals). strings gathered from the command line -XL argument to be parsed into intervals to exclude

List[String] []

--five-prime-flank-size

Variants within this many bases of the 5' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 5' flanking region of that transcript

int 5000 [ [ -∞ ∞ ] ]

--gatk-config-file

A configuration file to use with the GATK.

String null

--gcs-max-retries / -gcs-retries

If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection

int 20 [ [ -∞ ∞ ] ]

--gcs-project-for-requester-pays

Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed. User must have storage.buckets.get permission on the bucket being accessed.

String ""

--help / -h

display the help message

boolean false

--input / -I

BAM/SAM/CRAM file containing reads

List[GATKPath] []

--interval-exclusion-padding / -ixp

Amount of padding (in bp) to add to each interval you are excluding.
Use this to add padding to the intervals specified using -XL. For example, '-XL 1:100' with a padding value of 20 would turn into '-XL 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int 0 [ [ -∞ ∞ ] ]

--interval-merging-rule / -imr

Interval merging rule for abutting intervals
By default, the program merges abutting intervals (i.e. intervals that are directly side-by-side but do not actually overlap) into a single continuous interval. However you can change this behavior if you want them to be treated as separate intervals instead.

The --interval-merging-rule argument is an enumerated type (IntervalMergingRule), which can have one of the following values:

ALL
OVERLAPPING_ONLY

IntervalMergingRule ALL

--interval-padding / -ip

Amount of padding (in bp) to add to each interval you are including.
Use this to add padding to the intervals specified using -L. For example, '-L 1:100' with a padding value of 20 would turn into '-L 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int 0 [ [ -∞ ∞ ] ]

--interval-set-rule / -isr

Set merging approach to use for combining interval inputs
By default, the program will take the UNION of all intervals specified using -L and/or -XL. However, you can change this setting for -L, for example if you want to take the INTERSECTION of the sets instead. E.g. to perform the analysis only on chromosome 1 exomes, you could specify -L exomes.intervals -L 1 --interval-set-rule INTERSECTION. However, it is not possible to modify the merging approach for intervals passed using -XL (they will always be merged using UNION). Note that if you specify both -L and -XL, the -XL interval set will be subtracted from the -L interval set.

The --interval-set-rule argument is an enumerated type (IntervalSetRule), which can have one of the following values:

UNION: Take the union of all intervals
INTERSECTION: Take the intersection of intervals (the subset that overlaps all intervals specified)

IntervalSetRule UNION

--intervals / -L

One or more genomic intervals over which to operate

List[String] []

--inverted-read-filter / -XRF

Inverted (with flipped acceptance/failure conditions) read filters applied before analysis (after regular read filters).

List[String] []

--lenient / -LE

Lenient processing of VCF files

boolean false

--lookahead-cache-bp

Number of base-pairs to cache when querying variants. Can be overridden in individual data source configuration files.

int 100000 [ [ 0 ∞ ] ]

--max-variants-per-shard

If non-zero, partitions VCF output into shards, each containing up to the given number of records.

int 0 [ [ 0 ∞ ] ]

--min-num-bases-for-segment-funcotation

The minimum number of bases for a variant to be annotated as a segment. Recommended to be changed only for use with FuncotateSegments. Defaults to 150

int 150 [ [ -∞ ∞ ] ]

--output / -O

Output file to which annotated variants should be written.

R File null

--output-file-format

The output file format. Either VCF, MAF, or SEG. Please note that MAF output for germline use case VCFs is unsupported. SEG will generate two output files: a simple tsv and a gene list.

The --output-file-format argument is an enumerated type (OutputFormatType), which can have one of the following values:

VCF
MAF
SEG

R OutputFormatType null

--prefer-mane-transcripts

If this flag is set, Funcotator will prefer 'MANE_Plus_Clinical' followed by 'MANE_select' transcripts (including those not tagged 'basic') if one is present for a given variant. If neither tag is present it use the default behavior (only base transcripts).

boolean false

--QUIET

Whether to suppress job-summary info on System.err.

Boolean false

--read-filter / -RF

Read filters to be applied before analysis

List[String] []

--read-index / -read-index

Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.

List[GATKPath] []

--read-validation-stringency / -VS

Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.

The --read-validation-stringency argument is an enumerated type (ValidationStringency), which can have one of the following values:

STRICT
LENIENT
SILENT

ValidationStringency SILENT

--reannotate-vcf

When input VCF has already been annotated, still annotate again.

boolean false

--ref-version

The version of the Human Genome reference to use (e.g. hg19, hg38, etc.). This will correspond to a sub-folder of each data source corresponding to that data source for the given reference.

R String null

--reference / -R

Reference sequence file

R GATKPath null

--remove-filtered-variants

Ignore/drop variants that have been filtered in the input. These variants will not appear in the output file.

boolean false

--seconds-between-progress-updates / -seconds-between-progress-updates

Output traversal statistics every time this many seconds elapse

double 10.0 [ [ -∞ ∞ ] ]

--sequence-dictionary / -sequence-dictionary

Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.

GATKPath null

--showHidden / -showHidden

display hidden arguments

boolean false

--sites-only-vcf-output

If true, don't emit genotype fields when writing vcf file output.

boolean false

--splice-site-window-size

Number of bases on either side of a splice site for a variant to be classified as a SPLICE_SITE variant (default: 2).

int 2 [ [ 0 ∞ ] ]

--three-prime-flank-size

Variants within this many bases of the 3' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 3' flanking region of that transcript

int 0 [ [ -∞ ∞ ] ]

--tmp-dir

Temp directory to use.

GATKPath null

--transcript-list

File to use as a list of transcripts (one transcript ID per line, version numbers are ignored) OR A set of transcript IDs to use for annotation to override selected transcript.

Set[String] []

--transcript-selection-mode

Method of detailed transcript selection. This will select the transcript for detailed annotation (CANONICAL, ALL, or BEST_EFFECT).

The --transcript-selection-mode argument is an enumerated type (TranscriptSelectionMode), which can have one of the following values:

BEST_EFFECT: BEST_EFFECT Select a transcript to be reported with details with priority on effect according to the folowing list of selection criteria: Choose the transcript that is on the custom list specified by the user. If no list was specified, treat as if no transcripts were on the list (tie). In case of tie, choose the transcript that yields the variant classification highest on the variant classification rank list (see below). If still a tie, choose the transcript with highest level of curation. Note that this means lower number is better for level (see below). If still a tie, choose the transcript with the best appris annotation (see below). If still a tie, choose the transcript with the longest transcript sequence length. If still a tie, choose the first transcript, alphabetically. Levels of Curation: 1 (verified loci) 2 manually annotated loci 3 automatically annotated loci Variant Classification Scores (See as well): De_novo_Start_OutOfFrame 0 Nonsense_Mutation 0 Nonstop_Mutation 0 Missense_Mutation 1 De_novo_Start_InFrame 1 In_Frame_Del 1 In_Frame_Ins 1 Frame_Shift_Del 2 Frame_Shift_Ins 2 Frame_Shift_Sub 2 Start_Codon_SNP 3 Start_Codon_Del 3 Start_Codon_Ins 3 Start_Codon_DNP 3 Start_Codon_TNP 3 Start_Codon_ONP 3 Stop_Codon_SNP 3 Stop_Codon_Del 3 Stop_Codon_Ins 3 Stop_Codon_DNP 3 Stop_Codon_TNP 3 Stop_Codon_ONP 3 Splice_Site 4 Splice_Site_SNP 4 Splice_Site_Del 4 Splice_Site_Ins 4 Splice_Site_DNP 4 Splice_Site_TNP 4 Splice_Site_ONP 4 Splice_Site 4 miRNA 4 Silent 5 3UTR 6 5UTR 6 Intron 7 5Flank 8 3Flank 8 Non-coding_Transcript 9 IGR 20 TX-REF-MISMATCH 100 APPRIS Ranks (http://appris.bioinfo.cnio.es/): appris_principal appris_candidate_highest_score appris_candidate_longest_ccds appris_candidate_ccds appris_candidate_longest_seq appris_candidate_longest appris_candidate no appris tag present
CANONICAL: CANONICAL Select a transcript to be reported with details with priority on canonical order according to the folowing list of selection criteria: Choose the transcript that is on the custom list specified by the user. If no list was specified, treat as if all transcripts were on the list (tie). In case of tie, choose the transcript with highest level of curation. Note that this means lower number is better for level (see below). If still a tie, choose the transcript that yields the variant classification highest on the variant classification rank list (see below). If still a tie, choose the transcript with the best appris annotation (see below). If still a tie, choose the transcript with the longest transcript sequence length. If still a tie, choose the first transcript, alphabetically. Levels of Curation: 1 (verified loci) 2 manually annotated loci 3 automatically annotated loci Variant Classification Scores (See as well): De_novo_Start_OutOfFrame 0 Nonsense_Mutation 0 Nonstop_Mutation 0 Missense_Mutation 1 De_novo_Start_InFrame 1 In_Frame_Del 1 In_Frame_Ins 1 Frame_Shift_Del 2 Frame_Shift_Ins 2 Frame_Shift_Sub 2 Start_Codon_SNP 3 Start_Codon_Del 3 Start_Codon_Ins 3 Start_Codon_DNP 3 Start_Codon_TNP 3 Start_Codon_ONP 3 Stop_Codon_SNP 3 Stop_Codon_Del 3 Stop_Codon_Ins 3 Stop_Codon_DNP 3 Stop_Codon_TNP 3 Stop_Codon_ONP 3 Splice_Site 4 Splice_Site_SNP 4 Splice_Site_Del 4 Splice_Site_Ins 4 Splice_Site_DNP 4 Splice_Site_TNP 4 Splice_Site_ONP 4 Splice_Site 4 miRNA 4 Silent 5 3UTR 6 5UTR 6 Intron 7 5Flank 8 3Flank 8 Non-coding_Transcript 9 IGR 20 TX-REF-MISMATCH 100 APPRIS Ranks (http://appris.bioinfo.cnio.es/): appris_principal appris_candidate_highest_score appris_candidate_longest_ccds appris_candidate_ccds appris_candidate_longest_seq appris_candidate_longest appris_candidate no appris tag present
ALL: Same as CANONICAL, but indicates that no transcripts should be dropped. Render all overlapping transcripts.

TranscriptSelectionMode CANONICAL

--use-jdk-deflater / -jdk-deflater

Whether to use the JdkDeflater (as opposed to IntelDeflater)

boolean false

--use-jdk-inflater / -jdk-inflater

Whether to use the JdkInflater (as opposed to IntelInflater)

boolean false

--variant / -V

A VCF file containing variants

R GATKPath null

--variant-output-filtering

Restrict the output variants to ones that match the specified intervals according to the specified matching mode.

The --variant-output-filtering argument is an enumerated type (Mode), which can have one of the following values:

STARTS_IN: starts within any of the given intervals
ENDS_IN: ends within any of the given intervals
OVERLAPS: overlaps any of the given intervals
CONTAINED: contained completely within a contiguous block of intervals without overlap
ANYWHERE: no filtering

Mode null

--verbosity / -verbosity

Control verbosity of logging.

The --verbosity argument is an enumerated type (LogLevel), which can have one of the following values:

ERROR
WARNING
INFO
DEBUG

LogLevel INFO

--version

display the version number for this tool

boolean false

Return to top

GATK version 4.6.2.0 built at Sun, 13 Apr 2025 13:21:43 -0400.